1. Creature Creation:

Single Allele:

PP: Pyramid Head
ss: Spiky Hair

Codominant Trait:

ZX: One Big Eye and One Small Eye
GG: Purple Eyes

Multiple Allele Trait:

MT: Smile with Teeth Showing
LS: Long Skinny Legs
CS: Crippled Skinny arms

Sex-Linked Trait:

X^nX: Female, no nose

Incomplete Dominance:

RY: Red and Yellow Legs

2. The Creatures:

Genotype: PPssZXGGMTLSCSRYX^nX

Genotype: PPNhGSLLX^yXSTTP

PP: Pyramid Head

Nh: No Hair

GS: Green, Small Eyes

LL: Smiley

X^yX: Female with nose

ST: Short, Tan Arms

TP: Short Purple Legs

3. Single Allele Trait: Spiky Hair Pedigree

4. Single Allele Trait: Dihybrid Cross:

PP: Pyramid Head

ss: Spiky Hair

5. Three Practice Problems:

1. 1. Jumper’s mother is PP and her father is Pp, what was the percentage that Jumper would have been formed with a genotype of PP?

2. 2. If Jumper has children and the father is a man with Green Eyes (Pp) what percentage of her children would have one green, one purple eye? Two Purple? Two Green?

3. 3. What is the possibility that Jumpers children will have Huntington’s disease if her husband is a carrier?

5. Three Practice Problems:

1. 1. Jumper’s mother is PP and her father is Pp, what was the percentage that Jumper would have been formed with a genotype of PP?

2. 2. If Jumper has children and the father is a man with Green Eyes (Pp) what percentage of her children would have one green, one purple eye? Two Purple? Two Green?

3. 3. What is the possibility that Jumpers children will have Huntington’s disease if her husband is a carrier?

6. Pro-Sex Reassignment:

It is appropriate to change an individual from a "he" to a "she" (or vice versa) if there is a mistake in the organisms genetic development or in a surgical procedure.

As free citizens of America we should theoritically have the freedom to operate on our own bodies, and preform a sex reassignment operation. Suppose you were a man, who wanted to undergo this procedure to become a woman. Suppose you had Gender Identity Disorder, which is the condition when someone suffers from significant gender dyphoria. Would you want to be held hostage in a male body, where although your physical appearance is masculine, internally, you feel female and yearn to act the way a woman would. Life like that causes much distress, and you know the saying, "You only have one life to live, but if you live it to the fullest, one is all you need." If you had GID and you were unable to have the sex reassignment procedure, you would not have the will much less the ability to live your life to the fullest because your physical appearance will always stand in the way. So why not do one operation and then live your life "to the fullest". Moreover, one out of every two thousand babies born has ambiguous gentiles. And although this is rare, when it does occur, don't you think that baby should have the right to become either male or female, rather than living the rest of their life in embarrassment or confusion?
Although very few, there are still people out there who suffer from GID and are born as transsexuals, and don't they deserve a life as 'normal' as our own?

Facts:

Studies show that 9/10 transexual who undergo surgical sex reassignment surgery experience a satisfactory result.

This condition is usually not just the reluctenence to identify with the traditional roles of males and females, but it is also the inner sense to be the other gender.

GID may cause distress because the patient may be unsure about what type of cloths to wear at a social gatherings, who to bring with them as their guest, or how they should dance during the gathering.

Most Transsexuals are about 30 points higher than a regular individual.

Bibliography:

Human Genetics pg. 119- Sex reassignment: Making a Biological "He" into a Social "She"

http://www.faqs.org/health/topics/64/Sex-change-surgery.html#Comments_form

http://www.answerbag.com/q_view/106421

http://www.transsexual.org/aprimer.html

http://www.npr.org/templates/story/story.php?storyId=90273278

http://gidreform.org/gid30285.html

7. Debate Reflection:

I feel like I was successfully able to persuade my audience into being for sex reassignment. This debate was quite fun and difficult to do, because I have always been against the procedure. But, after researching the topic, I have learned that there are some people out their who need the surgery, such as babies who were born as transsexuals or people with the GID disorder. In all, I feel that the debate went pretty well, I talked for about 3 minutes, and the class seemed pretty engaged. I enjoyed rebutting, because I was able to say somethings that would prove my opponent, tin wrong. Although, tin did make some interesting points like the fact that the surgery has many hazards, but I countered this by saying that all surgeries have certain risks. He also mentioned that some people who get the surgery are usually not accepted in society, but I believe that in the end it is your own opinion, and your friends and family opinion that matters most. After completing this debate I was able to form my own opinion about the topic, and as it stands, I am neither for or against the procedure.

8. Who Blasphemed the Easter Bunny?!

Someone has blasphemed the Easter Bunny and I will not sleep until I uncover this mystery! Luckily, the culprit left a Lolly-Pop on the scene of the crime so not only do we have fingerprints, but we also have a DNA sample! Whoever you are, I suggest you turn yourself in before I uncover the mystery and get you thrown into prison!

The DNA Sequence:

GCCTATCCCGGGAGTCGTCAGGGTTATCGTTGAACTAGCTCAGTTCCCAG

The Complementary DNA Sequence:

CGGATAGGGCCCTCAGCAGTCCCAATAGCAACTTGATCGAGTCAAGGGTC

Radial Loop Fingerprint: